The research on glioblastoma requires the development of new preclinical murine models. The GL261 cell line forms glioma-like tumors in a reliable manner when transplanted intracranially, but these ...
A research team at the Institut de Neurociències of the Universitat Autònoma de Barcelona (INc-UAB) has developed a new ...
Researchers say study provides sufficient rationale to further explore the therapeutic uses of SSRIs during infection.
Megakaryocytes form a three-dimensional (3D) cage composed of laminin and collagen IV connected to the basement membrane surrounding them. This microarchitecture stabilizes megakaryocytes within their ...
Presentation Details Title: Efficacy and Safety of ETX-148 in Murine Models of Haemophilia A and B Format: Oral Presentation Presentation Number: OR10 Date: 7 th February 2025 Session: SLAM About ...
A 401-bp sequence of the murine beta-major gene was amplified using 5´â€“GAAGTTGGGTGCTTGGAGAC–3´ and 5´â€“GAGACTGCTCCCTAGAATCG–3´ as forward and reverse primers, respectively 27.
Polyvinyl alcohol 0.5%, povidone 0.6%; oph soln; contains benzalkonium chloride. Discontinue if eye pain, vision changes, redness or irritation persist beyond 72 hours or worsen.
Scientists at the University of Wisconsin Madison and Dana-Farber Cancer Institute recently presented preclinical data for the radiopharmaceutical therapy candidate [177Lu]PNT-6555.